Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 2960056
End position: 2960079
Length: 24

DNA sequence
>NC_009380, from 2960056 to 2960079 (24 bp); Salinispora tropica CNB-440 GCAGCGGCATCGGCAACGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2959848-2960969	Sequence	Strop_2638 - 2-nitropropane dioxygenase (Protein is coded in complementary strand; from 2960969 to 2959848)