Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 2904985
End position: 2905008
Length: 24

DNA sequence
>NC_009380, from 2904985 to 2905008 (24 bp); Salinispora tropica CNB-440 GGTGCCGGTCCCGGTGACCGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2903405-2905063	Sequence	Strop_2584 - hypothetical protein (Protein is coded in complementary strand; from 2905063 to 2903405)