Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 2894494
End position: 2894517
Length: 24

DNA sequence
>NC_009380, from 2894494 to 2894517 (24 bp); Salinispora tropica CNB-440 CAGCCCCACCCCCACCCCCACCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2894054-2894494	Sequence	Strop_2574 - hypothetical protein
ORF. 2894491-2894946	Sequence	Strop_2575 - hypothetical protein