Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 2858208
End position: 2858231
Length: 24

DNA sequence
>NC_009380, from 2858208 to 2858231 (24 bp); Salinispora tropica CNB-440 GGCGGCGACGGCGGCGACGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2857126-2858748	Sequence	Strop_2539 - hypothetical protein (Protein is coded in complementary strand; from 2858748 to 2857126)