Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 2763567
End position: 2763590
Length: 24

DNA sequence
>NC_009380, from 2763567 to 2763590 (24 bp); Salinispora tropica CNB-440 CAGGTCACCAGGTCACCAGGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2763572-2764234	Sequence	Strop_2458 - response regulator receiver (Protein is coded in complementary strand; from 2764234 to 2763572)