Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 2527524
End position: 2527547
Length: 24

DNA sequence
>NC_009380, from 2527524 to 2527547 (24 bp); Salinispora tropica CNB-440 GCCGGCACCGGCGCCGCCACCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2525217-2527766	Sequence	Strop_2233 - hypothetical protein (Protein is coded in complementary strand; from 2527766 to 2525217)