Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 2395910
End position: 2395933
Length: 24

DNA sequence
>NC_009380, from 2395910 to 2395933 (24 bp); Salinispora tropica CNB-440 AGGTCCAGATCCAGGTGCAGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2394839-2396149	Sequence	Strop_2118 nhaA pH-dependent sodium/proton antiporter (Protein is coded in complementary strand; from 2396149 to 2394839)