Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 2339417
End position: 2339440
Length: 24

DNA sequence
>NC_009380, from 2339417 to 2339440 (24 bp); Salinispora tropica CNB-440 GGCCGGTGGGCTGGTGGGCCGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2339329-2339712	Sequence	Strop_2066 - hypothetical protein (Protein is coded in complementary strand; from 2339712 to 2339329)