Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 172805
End position: 172828
Length: 24

DNA sequence
>NC_009380, from 172805 to 172828 (24 bp); Salinispora tropica CNB-440 GTAGTCGTCGTCGAAGTCGTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 172731-172946	Sequence	Strop_0158 - hypothetical protein (Protein is coded in complementary strand; from 172946 to 172731)