Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 1638703
End position: 1638726
Length: 24

DNA sequence
>NC_009380, from 1638703 to 1638726 (24 bp); Salinispora tropica CNB-440 CGATGCCGATGCCGATGCCGATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1638416-1639480	Sequence	Strop_1441 - hypothetical protein (Protein is coded in complementary strand; from 1639480 to 1638416)