Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 1427086
End position: 1427109
Length: 24

DNA sequence
>NC_009380, from 1427086 to 1427109 (24 bp); Salinispora tropica CNB-440 ACCGCCAACGCCAGCGCCAACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1426558-1427238	Sequence	Strop_1264 - hypothetical protein (Protein is coded in complementary strand; from 1427238 to 1426558)