Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 1344610
End position: 1344633
Length: 24

DNA sequence
>NC_009380, from 1344610 to 1344633 (24 bp); Salinispora tropica CNB-440 GGTGACGGTGGCGGTGAGCGTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1344245-1345978	Sequence	Strop_1193 - cell wall anchor domain-containing protein (Protein is coded in complementary strand; from 1345978 to 1344245)