Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 1135762
End position: 1135785
Length: 24

DNA sequence
>NC_009380, from 1135762 to 1135785 (24 bp); Salinispora tropica CNB-440 GTCCGCGTCCACGTCCACGTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1135115-1137265	Sequence	Strop_1010 - hypothetical protein (Protein is coded in complementary strand; from 1137265 to 1135115)