Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 4484259
End position: 4484312
Length: 54

DNA sequence
>NC_009338, from 4484259 to 4484312 (54 bp); Mycobacterium gilvum PYR-GCK GCGGTCTTCTTGGCCGGTGCCGCCTTCTTGGCGGGTGCGGCCTTCTTCGCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4484094-4484747	Sequence	Mflv_4225 - histone family protein DNA-binding protein (Protein is coded in complementary strand; from 4484747 to 4484094)