Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 284601
End position: 284654
Length: 54

DNA sequence
>NC_009338, from 284601 to 284654 (54 bp); Mycobacterium gilvum PYR-GCK ACTGCGGCACCTGCGGGACCTGCGGCACCTGCGGAATCTGAGGCACCTGCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 284417-286078	Sequence	Mflv_0290 - hypothetical protein (Protein is coded in complementary strand; from 286078 to 284417)