Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1895690
End position: 1895743
Length: 54

DNA sequence
>NC_009338, from 1895690 to 1895743 (54 bp); Mycobacterium gilvum PYR-GCK CTCGTCGGAGTCGTCCGAGTCGTCCGAGTCGTCCGAGTCGTCCGAGTCGTCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1895574-1896560	Sequence	Mflv_1826 - Ku domain-containing protein (Protein is coded in complementary strand; from 1896560 to 1895574)