Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3333112
End position: 3333162
Length: 51

DNA sequence
>NC_009338, from 3333112 to 3333162 (51 bp); Mycobacterium gilvum PYR-GCK CGCCTAGTTGACGACGTCGCCTAGTTGACGACGTCGCCTAGTTGACGACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3332887-3333123	Sequence	Mflv_3150 - hypothetical protein
ORF... 3333150-3333635	Sequence	Mflv_3151 - hypothetical protein (Protein is coded in complementary strand; from 3333635 to 3333150)