Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2814794
End position: 2814844
Length: 51

DNA sequence
>NC_009338, from 2814794 to 2814844 (51 bp); Mycobacterium gilvum PYR-GCK GATCTCCAGCAGAGCCGGTTCTACAGCAGAGCCGGTTCTACAGGAGAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2813600-2814796	Sequence	Mflv_2687 - coproporphyrinogen III oxidase
ORF... 2814832-2815692	Sequence	Mflv_2688 - hypothetical protein (Protein is coded in complementary strand; from 2815692 to 2814832)