Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 989034
End position: 989078
Length: 45

DNA sequence
>NC_009338, from 989034 to 989078 (45 bp); Mycobacterium gilvum PYR-GCK GGCCGCGGGAGTTGAACCCACGGGAGTTGAAGCCACGGGAGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 988207-989661	Sequence	Mflv_0946 - hypothetical protein (Protein is coded in complementary strand; from 989661 to 988207)