Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 847585
End position: 847629
Length: 45

DNA sequence
>NC_009338, from 847585 to 847629 (45 bp); Mycobacterium gilvum PYR-GCK GGCTCGTTGCGCGGTGGGTCATTGCGAGGTGGCTCGTTGCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 846988-847932	Sequence	Mflv_0820 - hypothetical protein (Protein is coded in complementary strand; from 847932 to 846988)