Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5536913
End position: 5536957
Length: 45

DNA sequence
>NC_009338, from 5536913 to 5536957 (45 bp); Mycobacterium gilvum PYR-GCK CGTCGGAGTCGTCGACGGCGGTGTCCTCGACGACGGTGTCCTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5534989-5537430	Sequence	Mflv_5192 - peptidase S15 (Protein is coded in complementary strand; from 5537430 to 5534989)