Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5266215
End position: 5266259
Length: 45

DNA sequence
>NC_009338, from 5266215 to 5266259 (45 bp); Mycobacterium gilvum PYR-GCK GCGGCGAGGGGCGCAGGCGCGACGGGCGCAGAGGGGACGGGCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5265738-5267129	Sequence	Mflv_4945 - hypothetical protein (Protein is coded in complementary strand; from 5267129 to 5265738)