Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5000600
End position: 5000644
Length: 45

DNA sequence
>NC_009338, from 5000600 to 5000644 (45 bp); Mycobacterium gilvum PYR-GCK GTAGTTGGCCGTCGGGTAGTTGGCCGTCGGGTAGTCGGCCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4999941-5000747	Sequence	Mflv_4694 - hypothetical protein (Protein is coded in complementary strand; from 5000747 to 4999941)