Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 4735414
End position: 4735458
Length: 45

DNA sequence
>NC_009338, from 4735414 to 4735458 (45 bp); Mycobacterium gilvum PYR-GCK GTGGTGGTCGTGGTCGGGGTGGTCGTGGTGGTGGTCGTGGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4735189-4735725	Sequence	Mflv_4449 - hypothetical protein (Protein is coded in complementary strand; from 4735725 to 4735189)