Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3569019
End position: 3569063
Length: 45

DNA sequence
>NC_009338, from 3569019 to 3569063 (45 bp); Mycobacterium gilvum PYR-GCK GACGCCGAATCCGACGCCGAGGAATCCGACGCCGAGGAATCCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3568938-3571289	Sequence	Mflv_3378 - hypothetical protein (Protein is coded in complementary strand; from 3571289 to 3568938)