Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2899929
End position: 2899973
Length: 45

DNA sequence
>NC_009338, from 2899929 to 2899973 (45 bp); Mycobacterium gilvum PYR-GCK TTGCCTCGTCGCTCTCTGCCTTTTCGCTCTCTGCCTTTTCGCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2899769-2900680	Sequence	Mflv_2755 - hypothetical protein (Protein is coded in complementary strand; from 2900680 to 2899769)