Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2700817
End position: 2700861
Length: 45

DNA sequence
>NC_009338, from 2700817 to 2700861 (45 bp); Mycobacterium gilvum PYR-GCK GAAGTCGAAGCCGCCGAAGTCGCCGCCACCGAAATCGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2700815-2701612	Sequence	Mflv_2584 - hypothetical protein (Protein is coded in complementary strand; from 2701612 to 2700815)