Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 257438
End position: 257482
Length: 45

DNA sequence
>NC_009338, from 257438 to 257482 (45 bp); Mycobacterium gilvum PYR-GCK TCTCGGTGGCCGGCGTCTCGGTGACCGGGATCTCCGTCACCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 257395-259248	Sequence	Mflv_0271 - hypothetical protein (Protein is coded in complementary strand; from 259248 to 257395)