Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1272756
End position: 1272800
Length: 45

DNA sequence
>NC_009338, from 1272756 to 1272800 (45 bp); Mycobacterium gilvum PYR-GCK GGGCCGCAGCGTCGCCGTCCGCAGCGTCGTCGTCCGCAGCATCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1272029-1273210	Sequence	Mflv_1216 - hypothetical protein (Protein is coded in complementary strand; from 1273210 to 1272029)