Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1201767
End position: 1201811
Length: 45

DNA sequence
>NC_009338, from 1201767 to 1201811 (45 bp); Mycobacterium gilvum PYR-GCK GGCCGGCGTGGTCAGACCGGGCGTGGTCAGGCCGGGCGTGGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1201393-1202367	Sequence	Mflv_1158 - hypothetical protein (Protein is coded in complementary strand; from 1202367 to 1201393)