Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1173297
End position: 1173341
Length: 45

DNA sequence
>NC_009338, from 1173297 to 1173341 (45 bp); Mycobacterium gilvum PYR-GCK GGCTTTCTTGGCGGGGGCCTTCTTGGCCGGAGCCTTCTTCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1173001-1173426	Sequence	Mflv_1125 - hypothetical protein (Protein is coded in complementary strand; from 1173426 to 1173001)