Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 4250727
End position: 4250762
Length: 36

DNA sequence
>NC_009338, from 4250727 to 4250762 (36 bp); Mycobacterium gilvum PYR-GCK CGTCGTGGTCGCGGTCGTCGTCGCCGTCGTGGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4248962-4251577	Sequence	Mflv_3994 - cell division protein FtsK (Protein is coded in complementary strand; from 4251577 to 4248962)