Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3863107
End position: 3863142
Length: 36

DNA sequence
>NC_009338, from 3863107 to 3863142 (36 bp); Mycobacterium gilvum PYR-GCK CTGAGGGAAGTCCTGAGGGAAGTCCTGCGGGAGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3863025-3863717	Sequence	Mflv_3622 - hypothetical protein (Protein is coded in complementary strand; from 3863717 to 3863025)