Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3676709
End position: 3676744
Length: 36

DNA sequence
>NC_009338, from 3676709 to 3676744 (36 bp); Mycobacterium gilvum PYR-GCK CGACCTCGGTCGCGACGTCGGTGGTGACCTCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3676459-3677577	Sequence	Mflv_3454 - hypothetical protein (Protein is coded in complementary strand; from 3677577 to 3676459)