Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3441193
End position: 3441228
Length: 36

DNA sequence
>NC_009338, from 3441193 to 3441228 (36 bp); Mycobacterium gilvum PYR-GCK CGGCCTCGATATCGGCCTCGATATCGGCCTGGATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3440994-3442169	Sequence	Mflv_3250 - hypothetical protein (Protein is coded in complementary strand; from 3442169 to 3440994)