Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 320914
End position: 320949
Length: 36

DNA sequence
>NC_009338, from 320914 to 320949 (36 bp); Mycobacterium gilvum PYR-GCK GGCCTGCGCGGACTGCGCGGCCTGCTCGGCCTGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 320744-321037	Sequence	Mflv_0324 - hypothetical protein (Protein is coded in complementary strand; from 321037 to 320744)