Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 311866
End position: 311901
Length: 36

DNA sequence
>NC_009338, from 311866 to 311901 (36 bp); Mycobacterium gilvum PYR-GCK AGGGCTCCGGCTTGGGCTCCGACTCGGGCTCCGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 311217-312755	Sequence	Mflv_0314 - hypothetical protein (Protein is coded in complementary strand; from 312755 to 311217)