Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 305593
End position: 305628
Length: 36

DNA sequence
>NC_009338, from 305593 to 305628 (36 bp); Mycobacterium gilvum PYR-GCK GGGGTCGTCGTGGTGGTCGTCGTCGTGGTCGTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 305407-307203	Sequence	Mflv_0308 - hypothetical protein (Protein is coded in complementary strand; from 307203 to 305407)