Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 1648455
End position: 1648490
Length: 36

DNA sequence
>NC_009338, from 1648455 to 1648490 (36 bp); Mycobacterium gilvum PYR-GCK GTGGCCGCTGCGGTGGCTGCTGCGGTGGCCGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1647255-1649285	Sequence	Mflv_1576 - hypothetical protein (Protein is coded in complementary strand; from 1649285 to 1647255)