Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 69917
End position: 69946
Length: 30

DNA sequence
>NC_009338, from 69917 to 69946 (30 bp); Mycobacterium gilvum PYR-GCK CTTCGGCTTCAGCTTCGACTTCGACTTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 68896-70197	Sequence	Mflv_0078 - hypothetical protein (Protein is coded in complementary strand; from 70197 to 68896)