Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5136373
End position: 5136402
Length: 30

DNA sequence
>NC_009338, from 5136373 to 5136402 (30 bp); Mycobacterium gilvum PYR-GCK CGTCGCCGTCGCCGTCGCCGTCGCCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5136330-5139335	Sequence	Mflv_4825 - transporter (Protein is coded in complementary strand; from 5139335 to 5136330)