Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5129868
End position: 5129897
Length: 30

DNA sequence
>NC_009338, from 5129868 to 5129897 (30 bp); Mycobacterium gilvum PYR-GCK GGCGGCGGAGGCGGCGGGGGTGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5129778-5130311	Sequence	Mflv_4819 - hypothetical protein (Protein is coded in complementary strand; from 5130311 to 5129778)