Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3852738
End position: 3852767
Length: 30

DNA sequence
>NC_009338, from 3852738 to 3852767 (30 bp); Mycobacterium gilvum PYR-GCK CGTCGGCGTTGGCGGCGGCGTCCGAGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3852245-3852865	Sequence	Mflv_3610 hisH imidazole glycerol phosphate synthase subunit HisH (Protein is coded in complementary strand; from 3852865 to 3852245)