Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2899781
End position: 2899810
Length: 30

DNA sequence
>NC_009338, from 2899781 to 2899810 (30 bp); Mycobacterium gilvum PYR-GCK GAGTCCGAGTCCGAGTCCGAGTCCGAGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2899769-2900680	Sequence	Mflv_2755 - hypothetical protein (Protein is coded in complementary strand; from 2900680 to 2899769)