Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 213483
End position: 213512
Length: 30

DNA sequence
>NC_009338, from 213483 to 213512 (30 bp); Mycobacterium gilvum PYR-GCK CGCGGCGGCGCGCGGCGTCGTGAGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 212857-213540	Sequence	Mflv_0226 - hypothetical protein (Protein is coded in complementary strand; from 213540 to 212857)