Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5422285
End position: 5422311
Length: 27

DNA sequence
>NC_009338, from 5422285 to 5422311 (27 bp); Mycobacterium gilvum PYR-GCK GACGTGTCTGACGTCTCTGACGTCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5420707-5422431	Sequence	Mflv_5098 - hypothetical protein (Protein is coded in complementary strand; from 5422431 to 5420707)