Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 5406033
End position: 5406059
Length: 27

DNA sequence
>NC_009338, from 5406033 to 5406059 (27 bp); Mycobacterium gilvum PYR-GCK CCACCGGAGCCACCGGAGCCACCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5405991-5408291	Sequence	Mflv_5091 - triple helix repeat-containing collagen (Protein is coded in complementary strand; from 5408291 to 5405991)