Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 497776
End position: 497802
Length: 27

DNA sequence
>NC_009338, from 497776 to 497802 (27 bp); Mycobacterium gilvum PYR-GCK GAGACGCCGGAGACACCGGAGACACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 497230-497844	Sequence	Mflv_0470 - hypothetical protein (Protein is coded in complementary strand; from 497844 to 497230)