Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 3889383
End position: 3889409
Length: 27

DNA sequence
>NC_009338, from 3889383 to 3889409 (27 bp); Mycobacterium gilvum PYR-GCK CGACGGCCTCGCCGGCCTTGACGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3888989-3892117	Sequence	Mflv_3644 ileS isoleucyl-tRNA synthetase (Protein is coded in complementary strand; from 3892117 to 3888989)