Sequence retrieval

Genome: Mycobacterium gilvum PYR-GCK
Start position: 2840671
End position: 2840697
Length: 27

DNA sequence
>NC_009338, from 2840671 to 2840697 (27 bp); Mycobacterium gilvum PYR-GCK GACACCGCCGACACCGCCGACACTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2836763-2841142	Sequence	Mflv_2697 - amino acid adenylation domain-containing protein